1Prevenção do câncer do colouterinoPaulo Newton Danzi SalviaMédico Anátomo Patologistapaulo@citocamp.com.brwww.citocamp.co...
2Prevenção do câncer do colouterinoRevisão NarrativaRevisão Sistemáticahttp://www.centrocochranedobrasil.org.br/http://www...
3http://www.aepcc.org/congreso/pdf/CONS-VPH.pdf
4http://www.ahrq.gov/Agency for Healthcare Research and QualitySystematic Evidence Reviews (SERs)Two Evidence-based Practi...
5http://www.ahrq.gov/clinic/uspstf/uspscerv.htm
6http://www.ahrq.gov/clinic/uspstf/uspscerv.htm
7
8
9
10http://www.ahrq.gov/clinic/uspstf/uspscerv.htm
11http://www.ahrq.gov/clinic/uspstf/uspscerv.htm
12• A USPSTF recomenda fortemente o screening demulheres para o câncer cervical cancer se elas sãosexualmente ativas e têm...
13• A USPSTF recomenda contra screening de rotina paramulheres que tiveram histerectomia total por doecçabenigna.• A USPST...
14
15
16
17
18• O exame citológico com técnica dePapanicolaou é recomendado para todas asmulheres sexualmente ativasindependentemente ...
19• A coleta de citologia pode serinterrompida aos 65 anos, se há examesanteriores normais. Pacientes idosasaparentemente ...
20• Há poucas evidências de que mulheressubmetidas a rastreamento anual tenhamrisco significativamente menor do que asque ...
21• O intervalo entre as coletas de citologia, noentanto, deve variar entre um e três anosbaseado na presença de fatores d...
22A avaliação sistemática de novas tecnologias paraobtenção de amostras e sua manipulação (thin-layer cytology, re-análise...
23• A histerectomia abdominal ou vaginal podeser aceita como tratamento para as pacientescom prole formada. É indicada par...
24• Uma alternativa nas situações em que asmargens do cone estão comprometidas é oseguimento com citologia e colposcolpia4...
25Por que?É possível? De que forma?Prevenção do câncer do colouterino
26Por que?Prevenção do câncer do colouterino
27Fontes de dados de informaçãosobre câncer no Brasil?Sistema de informação sobre mortalidade - SIMhttp://tabnet.datasus.g...
281. Dados dos Registros de CâncerPopulacionais e Hospitalares2. Dados de Mortalidade
291. Dados dos Registros de CâncerPopulacionais e Hospitalaresa. Registros de Câncer de BasePopulacional – RCBP– informaçõ...
30Fontes: SIM - Sistema de Informaçãosobre Mortalidade/Ministério da Saúde;INCA/MS; DPE/DEPIS/IBGEhttp://tabnet.datasus.go...
31
32http://www.inca.gov.br/
33http://www.inca.gov.br/
34http://www.inca.gov.br/
351. Prevalência altaFreqüência dadoença napopulaçãoestudada.Câncer do colo do útero
36
37http://www.inca.gov.br/
381. Prevalência alta2. Mortalidade altaCâncer do colo do útero• 2002 : Casos Novos: 17.600 Óbitos : 4.005
39Por que?É possível? De que forma?Prevenção do câncer do colouterino
40É possível?Prevenção do câncer do colouterino
41Harald zur HausenNature - Maio/2002 – Vol 2 • www.nature.com/reviews/cancer
42Há uma forte evidência de que o DNAdo HPV parece ser um fator necessáriopara o aparecimento de câncer cervical(SOLOMON e...
43
44http://www.aepcc.org/congreso/pdf/CONS-VPH.pdf
45http://www.aepcc.org/congreso/pdf/CONS-VPH.pdf
461035 amostras CA cervicalPCR DNA-HPV93 % Positivos7 % NegativosDos negativos restantes38 % não tinham tecidotumoral na a...
471. Quase todas as amostras de CA cervicalcontêm DNA do HPV (BOSCH et al., 1995; ROLON etal., 2000);Associação do HPV com...
48Taxa de aquisição do HPVem virgens após o início das relaçõessexuais70 %40 %USL. Koutsky35.2 %DinamarcaS.K.Kjoer 2001Apó...
49EUA Média em meses• Qualquer 8• Alto Risco 6-8• 16 16,4Bosch, Florianópolis 2001Brasil• Alto Risco 13,5• Baixo Risco 8,2...
50
51HbsAG / CA Fígado 20HCV / CA FígadoPós vacina / HVB Korea 0,6Pós vacina / HVB Taiwan 0,1Cigarro / CA Pulmão 10HPV / CA c...
52• 16 435• 59 419• 33 373• 18 248Risco Relativo para CA cervicalsegundo o tipo de HPVhttp://www.aepcc.org/congreso/pdf/CO...
53PersistênciaViral
54Lesãointraepitelialescamosa
55• Estudo Longitudinal (Ludwig-Mcgill)• 1611 mulheres com 1º CO normal (1993 a 1997)• CO e DNA 4 em 4 meses no 1º ano, de...
56
57http://www.aepcc.org/congreso/pdf/CONS-VPH.pdf
58O Valor Preditivo do DNA-HPVpara o desenvolvimento de LIE eCâncer Cervical aumenta muitoapós os 30 anos de Idade
59Lesão ou neoplasia ?• OMS:– neoplasia intraepitelial cervical (NIC) I, II e III• Bethesda System, 2001:– lesão intraepit...
601. Lesão de baixo grau pode evoluir e se tornar dealto grau, mas a maioria regride espontaneamente(BOSCH et al., 1995)Le...
61• Ostor (1993)• Revisão com 3529 casosEur J Obstet Gynecol Reprod Biol 1996 Mar;65(1):45-53Syrjanen KJInt J Gynecol Path...
62NIC I NIC II NIC IIIRegressão 60% 40%, 33%Persistência 30% 40%,Progressão paraNIC III10% 20%,Progressão paraCancer Invas...
63• Melnikow J e col (1998)• Selecionaram 15 de 81 estudos• 27929 pacientesObstet Gynecol 1998 Oct;92(4 Pt 2):727-35Melnik...
64PAP Progressão Progressão Regressãoa HSIL a CÂNCERASCUS 7.13% O,25% 68.19%LSIL 20.81% 0,15% 47.39%HSIL 23,37% 1,44% 35.0...
65• Noruega – Efeito do tratamento dos NIC III naincidência de CA (1965-92)Int J Cancer 1997 Mar 28;71(1):4-8Forsmo S, Buh...
661. Prevalência alta2. Mortalidade alta3. Evolução crônicaCâncer do colo do útero20anos
67Associação LIE-HPV– O HPV está relacionado às lesõesintraepiteliais tanto quanto aos cânceresinvasivos avançados(SCHIFFM...
683488 mulheres com PapanicolaouASCUS-LSIL Triage-Study (ALTS)LSIL (Baixo Grau) ASCUSJournal of the National Cancer Instit...
69ASCUS-LSIL Triage-Study (ALTS) 82.9% (532 de 642) foram positivas paraHR DNA-HPV (alto risco)J Natl Cancer Inst. 2000 M...
70ASCUS-LSIL Triage-Study (ALTS)• 20-60% se associam a LIE• 30-50 % se associam ao HPV de AltoRisco• 5,1 % tiveram diagnós...
71Teste de DNA• Sensibilidade96.3% para NIC III95.9% para NIC IICitologia OncóticaSensibilidade44,1% para NIC III(OBS.:Amo...
72• SE NEGATIVO:SEM LESÃO TRIAGEM• SE POSITIVO :PROVÁVEL LESÃO COLPOSCOPIATeste de DNA-HPV em ASCUSINDICA :
73Interpretativo• Nota : Em combinaçãoos achados sãoconsistentes com LSILProbabilístico• Os achados sugerementre 10 a 20 %...
74CA “IN SITU” CÂNCERFatores Promotores( PERSISTÊNCIA VIRAL, reativaçãoda infecção,oncoproteínas,fatorescromossômicos do h...
75Carcinoma “in situ”EspontaneamenteNIC III 24 meses 20 anosProgressão/CA invasor 1.44% 20%Regressão 35.03% 80%CA “IN SITU...
76Carcinoma “in situ”Sabemos:CONIZAÇÃO CERVICALDEPOIS (?) SEGUIMENTODOENÇA RESIDUALCURADACA “IN SITU” CÂNCER
77• Diagnóstico pósconização• Carcinoma invasor• Lesão IntraepitelialEscamosa• Taxa de Recidiva• 50-60% de recidiva• 20-80...
78• Profundidade deinvasão• Extensão lateral dalesão• Lesão unifocal ouextensa• Invasão vascular• Sinais morfológicos dein...
79Doença residual pós conização• Conclusão:• Neoplasia residual na histerectomia foimais frequente quando as margens docon...
80Uma et al. Gynecolo Oncol 67:1997Doença residual pós conizaçãoLIE ResidualSIM NÃO71 Pacientes 29 42% DNA-HPV 96 0Conizadas
81• 699 pacientes (electrosurgical)• Doença residual: 38 pacientes (5.4%)Doença residual pós conizaçãoGynecol Oncol 2002 A...
82• 79 cones pacientes com NIC IIIDoença residual pós conizaçãoGynecol Oncol 2001 Jul;82(1):177-80Jain S, Tseng CJ, Horng ...
83• 79 cones pacientes com NIC IIIDoença residual pós conização• Margens negativas32(59,5%)• DNA HPVPOS 7 (22%) *NEG 25 (7...
84Sensibilidade:PAP: 62% DNA-HPV: 90%• Valor Preditivo Negativo(PAP normal + HPV Negativo) : 99 %Alex Ferenczy, Quebec,Flo...
85Revisão de 9 estudos de recorrência de LIE pósconeJack Cuzick – London,England, Florianópolis 2001Doença residual pós co...
861. O DNA-HPV no CA SITU” (NIC III) é o melhorindicador de doença residual pós cone, identificando adoença que irá progre...
87http://www.aepcc.org/congreso/pdf/CONS-VPH.pdf
881. Prevalência alta2. Mortalidade alta3. Evolução crônica4. Pode ser detectado em uma fase precoce5. Pode ser tratado em...
89Por que?É possível? De que forma?Prevenção do câncer do colouterino
90De que forma?Prevenção do câncer do colouterino
911. Detecta atipias celulares,2. Alteração compatível com LIE: a paciente ésubmetida à colposcopia e biópsia dirigidaCito...
92
93• Pequenos• Oncogênicos• Livres delipídios• Similares àMicroscopiaEletrônica Os Papilomavírus são encontrados em animai...
94Family orUnassigned genusNatureof thegenomePresenceof anenvelopeMorphology GenomeConfigurationGenomeSize kbpor kbHostIri...
95Papovaviridae - Papovaviruses ICTV - Datas Links! TutorialFamily Genus EM Images Example Virus Diseases Polyomavirus N/...
96 Papilomavírus  Polyomavírus “Vacuolatingvírus" (SV 40)Melnich PAPOVAVÍRUS :
97 1973 The International Committee on Nomenclature ofViruses (ICNV) se transformou em International Committeeon Taxonomy...
98
99Human papillomavirus type 16,complete genome [1..1000]
100PRIMERS DE L1 (My09 e My11) 6583-6602/7015-7034 (GP5+ e GP6+) 6624-6649/6719-67466541 TCTATCCC AAATATTCAA TAAACCTTAT TG...
101MY 09/11GP5+/6+ RFLP• Controles +/-• HPV +/-• ß globina (casos 1 e 2 )• HPV +/-• Água + ß globina• HPV – (contr) + MY
102• Digestão enzimática e análisepelo polimorfismo dostamanhos dos fragmentos derestrição• Sete enzimas de restrição:Bam ...
103Marcos Históricos
104Primeiras observações• 1907 - Ciuffo : Afirma que as Verrugas da pele têmEtiologia Viral (auto-inoculação)• 1924 - Serr...
105 1949 Teoria Unicista- (Microscopia Eletrônica) : Condições benignas,Verrugas de Pele e Genitais e Papiloma de Laringe...
106Meados de 1970Zur Hausen - Sugere associaçãoentre HPV e Câncer Genital• Zur Hausen H. Condylomata acuminata and human g...
107 Hibridização Molecular (e Endonucleases de Restrição)entre extratos de diferentes lesões verrucosas : DNAs de condil...
1081976-1977Estudos epidemiológicosImplicam o HPV na etiologia docâncer genital.• Kessler IL. Human cervical cancer as a v...
1091978Primeiros estudos comMicroscopia EletrônicaDella Torre G, Pilotti S, De Palo G, Rilke F. Viral particles incervical...
110
111• 1981 - Viliens e col produziram o primeiro clone deDNA de HPV, HPV-6, extraído de verrugas genitais.• 1982 - Gissmann...
1121983Zur Hausen - Identifica os HPVs16 e 18 em 70% dos cânceres cervicais.• Durst M, Gissmann L, Idenburg H, Zur Hausen ...
113• Prevalence of Human Papillomavirus in Cervical Cancer: AWorldwide Perspective[J Natl Cancer Inst 87:796-802, 1995]F. ...
114
115Tipos Virais
116Papillomavirus infections--a major cause of human cancers.Zur Hausen H Deutsches Krebsforschungszentrum, Heidelberg,Ger...
117 1976 - 4 1980- 6 1982- 13 1983- 24ftp://ftp-t10.lanl.gov/pub/papilloma/GenBank-files/Human-papillomahttp://hpv-web...
118http://www.aepcc.org/congreso/pdf/CONS-VPH.pdf
11923 tipos ano-genitais• Alto risco : 16, 18, 31, 33, 35, 39, 45, 51,52,56, 58, 59, 68• Baixo Risco : 6, 11, 42, 43, 44Ad...
120 Somente determinados tipos de HPV sãoligados ao câncer cervical. Estes sãochamados de alto risco. Os tipos de HPV qu...
121Diferença entre os gruposde alto e baixo riscoPapel transformante dos produtosdos genes E6 e E7 (oncoproteínas)• Advanc...
122Gene: Function:E1 Initiation of DNA replicationE2 Transcriptional regulation/DNA replicationE3 ???E4 Disrupts cytoskele...
123http://www.aepcc.org/congreso/pdf/CONS-VPH.pdf
124http://www.aepcc.org/congreso/pdf/CONS-VPH.pdf
125GenesE6/E7OncoproteínasCodificamP53,RbInativamImortalizaçãoda célulaProteínas supressorasdo Câncer
126F.X.Bosch IARC , Florianópolis 2001Mulheres com CA50-60 %10-12 %4.5 %Mulheres sem Lesão20 %10 %8 %Prevalência:Tipo16183...
127 10, 3% de mulheres da populaçãobrasileira são HPV-DNA positivasASCO - American Society of Clinical Oncology, 1438-199...
128Positividade de DNA HPVconforme o métodoBosch, FlorianópolisMétodo• FISH• Dot Blot• Southern Blot• PCR (MY 09/11)• PCR ...
129
130Muito obrigadoPaulo Newton Danzi SalviaMédico Anátomo Patologistapaulo@citocamp.com.brwww.citocamp.com.br
of 130

Prevenção do cancer do colo uterino

Published on: Mar 4, 2016
Source: www.slideshare.net


Transcripts - Prevenção do cancer do colo uterino

  • 1. 1Prevenção do câncer do colouterinoPaulo Newton Danzi SalviaMédico Anátomo Patologistapaulo@citocamp.com.brwww.citocamp.com.br
  • 2. 2Prevenção do câncer do colouterinoRevisão NarrativaRevisão Sistemáticahttp://www.centrocochranedobrasil.org.br/http://www.guideline.gov/http://www.projetodiretrizes.org.br/
  • 3. 3http://www.aepcc.org/congreso/pdf/CONS-VPH.pdf
  • 4. 4http://www.ahrq.gov/Agency for Healthcare Research and QualitySystematic Evidence Reviews (SERs)Two Evidence-based Practice Centers1. Oregon Health Sciences University2. Research Triangle Institute-Universityof North Carolina
  • 5. 5http://www.ahrq.gov/clinic/uspstf/uspscerv.htm
  • 6. 6http://www.ahrq.gov/clinic/uspstf/uspscerv.htm
  • 7. 7
  • 8. 8
  • 9. 9
  • 10. 10http://www.ahrq.gov/clinic/uspstf/uspscerv.htm
  • 11. 11http://www.ahrq.gov/clinic/uspstf/uspscerv.htm
  • 12. 12• A USPSTF recomenda fortemente o screening demulheres para o câncer cervical cancer se elas sãosexualmente ativas e têm cervix.• A USPSTF recomenda contra screening de rotina paramulheres com idade superior a 65 se elas têm recentementeuma citologia normal e não têm outro risco para câncercervical.U.S. Preventive Services Task ForceScreening for Cervical Cancer (USPSTF)Release Date: January 2003http://www.ahrq.gov/clinic/uspstf/uspscerv.htm
  • 13. 13• A USPSTF recomenda contra screening de rotina paramulheres que tiveram histerectomia total por doecçabenigna.• A USPSTF conclui que a evidência é insuficiente pararecomendar a favor ou contra novas tecnologias (comoThinPrep®) no lugar da citologia convencional.• A USPSTF conclui que a evidência é insuficiente pararecomendar a favor ou contra o teste para o PapilomavírusHumano (HPV) como teste de screening primário paracâncer cervical.http://www.ahrq.gov/clinic/uspstf/uspscerv.htmU.S. Preventive Services Task ForceScreening for Cervical Cancer (USPSTF)Release Date: January 2003
  • 14. 14
  • 15. 15
  • 16. 16
  • 17. 17
  • 18. 18• O exame citológico com técnica dePapanicolaou é recomendado para todas asmulheres sexualmente ativasindependentemente da idade. Mulheres quenão tiveram atividade sexual não estão sobrisco para câncer de colo e por isso não hánecessidade de rastreamento para estegrupo 3,4(C).
  • 19. 19• A coleta de citologia pode serinterrompida aos 65 anos, se há examesanteriores normais. Pacientes idosasaparentemente não se beneficiam dorastreamento, se exames anterioresforam normais repetidamente 4(C).
  • 20. 20• Há poucas evidências de que mulheressubmetidas a rastreamento anual tenhamrisco significativamente menor do que asque são examinadas a cada três anos. Estasconclusões foram confirmadas em umestudo que incluiu oito programas derastreamento na Europa e Canadáenvolvendo cerca de 1,8 milhão demulheres 13(B).
  • 21. 21• O intervalo entre as coletas de citologia, noentanto, deve variar entre um e três anosbaseado na presença de fatores de risco taiscomo início precoce da atividade sexual,história de múltiplos parceiros, e nívelsocioeconômico baixo 18(B). Deve seranual se algum destes fatores estiverpresente.
  • 22. 22A avaliação sistemática de novas tecnologias paraobtenção de amostras e sua manipulação (thin-layer cytology, re-análise por computação e usode redes neurais) mostra que a implantação dasnovas tecnologias melhora a sensibilidade dorastreamento, mas com um aumento substancialdos custos . Assim, não se justifica o uso derotina destes métodos 19, 20(A).
  • 23. 23• A histerectomia abdominal ou vaginal podeser aceita como tratamento para as pacientescom prole formada. É indicada para oscasos em que o cone apresenta margenscomprometidas também em pacientes comprole formada 30(D).
  • 24. 24• Uma alternativa nas situações em que asmargens do cone estão comprometidas é oseguimento com citologia e colposcolpia42(B), inicialmente trimestrais eposteriormente semestrais, durante doisanos. Se houver condições locais pode serefetuada nova conização.
  • 25. 25Por que?É possível? De que forma?Prevenção do câncer do colouterino
  • 26. 26Por que?Prevenção do câncer do colouterino
  • 27. 27Fontes de dados de informaçãosobre câncer no Brasil?Sistema de informação sobre mortalidade - SIMhttp://tabnet.datasus.gov.br/cgi/sim/obtdescr.htmhttp://www.inca.gov.br/
  • 28. 281. Dados dos Registros de CâncerPopulacionais e Hospitalares2. Dados de Mortalidade
  • 29. 291. Dados dos Registros de CâncerPopulacionais e Hospitalaresa. Registros de Câncer de BasePopulacional – RCBP– informações sobre a incidência do câncerem uma população geograficamentedefinidab. Registros Hospitalares de Câncer - RHC– informações sobre as características dostumores e a avaliação da sobrevida eassistência prestada ao paciente
  • 30. 30Fontes: SIM - Sistema de Informaçãosobre Mortalidade/Ministério da Saúde;INCA/MS; DPE/DEPIS/IBGEhttp://tabnet.datasus.gov.br/cgi/sim/obtdescr.htm2. Dados de Mortalidade
  • 31. 31
  • 32. 32http://www.inca.gov.br/
  • 33. 33http://www.inca.gov.br/
  • 34. 34http://www.inca.gov.br/
  • 35. 351. Prevalência altaFreqüência dadoença napopulaçãoestudada.Câncer do colo do útero
  • 36. 36
  • 37. 37http://www.inca.gov.br/
  • 38. 381. Prevalência alta2. Mortalidade altaCâncer do colo do útero• 2002 : Casos Novos: 17.600 Óbitos : 4.005
  • 39. 39Por que?É possível? De que forma?Prevenção do câncer do colouterino
  • 40. 40É possível?Prevenção do câncer do colouterino
  • 41. 41Harald zur HausenNature - Maio/2002 – Vol 2 • www.nature.com/reviews/cancer
  • 42. 42Há uma forte evidência de que o DNAdo HPV parece ser um fator necessáriopara o aparecimento de câncer cervical(SOLOMON et al., 2001; BOSCH et al., 1995).Associação do HPV com ocâncer do colo uterino
  • 43. 43
  • 44. 44http://www.aepcc.org/congreso/pdf/CONS-VPH.pdf
  • 45. 45http://www.aepcc.org/congreso/pdf/CONS-VPH.pdf
  • 46. 461035 amostras CA cervicalPCR DNA-HPV93 % Positivos7 % NegativosDos negativos restantes38 % não tinham tecidotumoral na amostraApós Re-cálculo99,7 % DNA de HPVno Carcinoma CervicalPCR com nova geraçãode primersGP5+/GP6+,CP I/II,SPE7,E6F. Xavier Bosch, M. Michele Manos et al.,19954 % se Positivaram
  • 47. 471. Quase todas as amostras de CA cervicalcontêm DNA do HPV (BOSCH et al., 1995; ROLON etal., 2000);Associação do HPV com ocâncer do colo uterino2. Estudos epidemiológicos de coorte demonstraramque 2 fatores são necessários para o desenvolvimentoda neoplasia o seu desaparecimento prediz aregressão:• PRESENÇA E PERSISTÊNCIA do DNA-HPVoncogênico(International Agency for Research on Cancer - IARC, 2002)
  • 48. 48Taxa de aquisição do HPVem virgens após o início das relaçõessexuais70 %40 %USL. Koutsky35.2 %DinamarcaS.K.Kjoer 2001Após 56 mesesApós 24 mesesBosch, Florianópolis 2001
  • 49. 49EUA Média em meses• Qualquer 8• Alto Risco 6-8• 16 16,4Bosch, Florianópolis 2001Brasil• Alto Risco 13,5• Baixo Risco 8,2Período médio da Infecção
  • 50. 50
  • 51. 51HbsAG / CA Fígado 20HCV / CA FígadoPós vacina / HVB Korea 0,6Pós vacina / HVB Taiwan 0,1Cigarro / CA Pulmão 10HPV / CA cervical * 100HPV 18 / AdenoCA * 1000F.X.Bosch IARC , Florianópolis 2001Risco Relativo para CA cervicalde portadoras de HPV
  • 52. 52• 16 435• 59 419• 33 373• 18 248Risco Relativo para CA cervicalsegundo o tipo de HPVhttp://www.aepcc.org/congreso/pdf/CONS-VPH.pdf
  • 53. 53PersistênciaViral
  • 54. 54Lesãointraepitelialescamosa
  • 55. 55• Estudo Longitudinal (Ludwig-Mcgill)• 1611 mulheres com 1º CO normal (1993 a 1997)• CO e DNA 4 em 4 meses no 1º ano, depois 2x/anoLIE-Infecção persistenteSchlecht NF e col. JAMA 2001 Dec 26;286(24):3106-14– Mulheres livres de HPV nas 2 primeiras visitas:• 0,73 LIE/1000 mulheres meses– Mulheres com INFECÇÃO PERSISTENTE pelos HPVs tipos 16 ou 18em ambas as visitas:• 8,68 LIE/1000 mulheres meses / RR de 10,19 (95% CI, 5,9-17,6)
  • 56. 56
  • 57. 57http://www.aepcc.org/congreso/pdf/CONS-VPH.pdf
  • 58. 58O Valor Preditivo do DNA-HPVpara o desenvolvimento de LIE eCâncer Cervical aumenta muitoapós os 30 anos de Idade
  • 59. 59Lesão ou neoplasia ?• OMS:– neoplasia intraepitelial cervical (NIC) I, II e III• Bethesda System, 2001:– lesão intraepitelial escamosa de baixo grau(LIEBG) e de alto grau (LIEAG)
  • 60. 601. Lesão de baixo grau pode evoluir e se tornar dealto grau, mas a maioria regride espontaneamente(BOSCH et al., 1995)Lesão ou neoplasia ?2. Baixa concordância entre observadores nagraduação das NIC(SPITZER et al, 1990; KURMAN et al, 1991; LAZCANO PONCE et al,1997; DE RUIZ et al, 1996; CIATTO et al, 1996; YOUNG et al, 1994)
  • 61. 61• Ostor (1993)• Revisão com 3529 casosEur J Obstet Gynecol Reprod Biol 1996 Mar;65(1):45-53Syrjanen KJInt J Gynecol Pathol 1993 Apr;12(2):186-92Ostor AG.Comportamento Biológicodas LIEEvolução espontânea das LIE
  • 62. 62NIC I NIC II NIC IIIRegressão 60% 40%, 33%Persistência 30% 40%,Progressão paraNIC III10% 20%,Progressão paraCancer Invasivo1% 5%, 12%Evolução espontânea das LIE
  • 63. 63• Melnikow J e col (1998)• Selecionaram 15 de 81 estudos• 27929 pacientesObstet Gynecol 1998 Oct;92(4 Pt 2):727-35Melnikow J, Nuovo J, Willan AR, Chan BK, Howell LP.Evolução espontânea das LIERevisão História Natural das LIE
  • 64. 64PAP Progressão Progressão Regressãoa HSIL a CÂNCERASCUS 7.13% O,25% 68.19%LSIL 20.81% 0,15% 47.39%HSIL 23,37% 1,44% 35.03%Estatísticas de progressão e regressão em 24 mesesObstet Gynecol 1998 Oct;92(4 Pt 2):727-35Melnikow J, Nuovo J, Willan AR, Chan BK, Howell LP.Evolução espontânea das LIE
  • 65. 65• Noruega – Efeito do tratamento dos NIC III naincidência de CA (1965-92)Int J Cancer 1997 Mar 28;71(1):4-8Forsmo S, Buhaug H, Skjeldestad FE, Haugen OA.– Probabilidade progressão de NIC III paraCâncer invasivo:– 20% / Tempo médio: 16 anos– 4/5 mulheres com NIC III não progrediriamMulheres sem nenhuma intervenção:Evolução espontânea das LIE
  • 66. 661. Prevalência alta2. Mortalidade alta3. Evolução crônicaCâncer do colo do útero20anos
  • 67. 67Associação LIE-HPV– O HPV está relacionado às lesõesintraepiteliais tanto quanto aos cânceresinvasivos avançados(SCHIFFMAN et al., 1993; MUNOZ et al., 1993; OLSEN et al., 1995;KJAER et al., 1996; HERRERO et al., 2000; SCHIFFMAN et al., 2000)
  • 68. 683488 mulheres com PapanicolaouASCUS-LSIL Triage-Study (ALTS)LSIL (Baixo Grau) ASCUSJournal of the National Cancer Institute,Vol. 93, No. 4, 293-299, February 21, 2001 Colposcopia (1163) HC2 DNA-HPV (1161) CO ThinPrep (1164)Detecção deNIC II,III ou CA
  • 69. 69ASCUS-LSIL Triage-Study (ALTS) 82.9% (532 de 642) foram positivas paraHR DNA-HPV (alto risco)J Natl Cancer Inst. 2000 Mar 1;92(5):397-402.Cox JT, Koutsky L, Schiffman M, Solomon D.3488 mulheres com PapanicolaouLSIL (Baixo Grau)
  • 70. 70ASCUS-LSIL Triage-Study (ALTS)• 20-60% se associam a LIE• 30-50 % se associam ao HPV de AltoRisco• 5,1 % tiveram diagnóstico de NIC III3488 mulheres com PapanicolaouASCUS
  • 71. 71Teste de DNA• Sensibilidade96.3% para NIC III95.9% para NIC IICitologia OncóticaSensibilidade44,1% para NIC III(OBS.:Amostra única)ASCUS-LSIL Triage-Study (ALTS)ASCUS 5,1 % tiveram NIC III• Valor Preditivo Negativo98.9% para NIC II99.5% para NIC III
  • 72. 72• SE NEGATIVO:SEM LESÃO TRIAGEM• SE POSITIVO :PROVÁVEL LESÃO COLPOSCOPIATeste de DNA-HPV em ASCUSINDICA :
  • 73. 73Interpretativo• Nota : Em combinaçãoos achados sãoconsistentes com LSILProbabilístico• Os achados sugerementre 10 a 20 % deuma HSIL subjacenteLaudo inicial: ASCUSHPV DNA POSITIVOTeste de DNA-HPV em ASCUSRobert Kurman Baltimore, US,Florianópolis, 2001
  • 74. 74CA “IN SITU” CÂNCERFatores Promotores( PERSISTÊNCIA VIRAL, reativaçãoda infecção,oncoproteínas,fatorescromossômicos do hospedeiro)Carcinoma “in situ”Sabemos:
  • 75. 75Carcinoma “in situ”EspontaneamenteNIC III 24 meses 20 anosProgressão/CA invasor 1.44% 20%Regressão 35.03% 80%CA “IN SITU” CÂNCERSabemos:
  • 76. 76Carcinoma “in situ”Sabemos:CONIZAÇÃO CERVICALDEPOIS (?) SEGUIMENTODOENÇA RESIDUALCURADACA “IN SITU” CÂNCER
  • 77. 77• Diagnóstico pósconização• Carcinoma invasor• Lesão IntraepitelialEscamosa• Taxa de Recidiva• 50-60% de recidiva• 20-80 % não terãodoença residual• Margens livres: 4%terão doença residual noseguimentoDoença residual pós conizaçãoAlex Ferenczy Quebec, Florianópolis 2001Uma et al. Gynecolo Oncol 67:1997Murdoch et al , Br J Obstet Gynecol 99:1992
  • 78. 78• Profundidade deinvasão• Extensão lateral dalesão• Lesão unifocal ouextensa• Invasão vascular• Sinais morfológicos deinfecção pelo HPVMargens cirúrgicaslivres oucomprometidasDoença residual pós conização• Histerectomia pós cone (CA microinvasivo)• 163 casos, 1967 a 1994 (Unicamp)Gynecol Oncol 1997 Jun;65(3):437-40..Gurgel MS, Bedone AJ, Andrade LA, Panetta K
  • 79. 79Doença residual pós conização• Conclusão:• Neoplasia residual na histerectomia foimais frequente quando as margens docone estavam comprometidas e quandohavia sinais de infecção pelo HPV.Gynecol Oncol 1997 Jun;65(3):437-40..Gurgel MS, Bedone AJ, Andrade LA, Panetta K
  • 80. 80Uma et al. Gynecolo Oncol 67:1997Doença residual pós conizaçãoLIE ResidualSIM NÃO71 Pacientes 29 42% DNA-HPV 96 0Conizadas
  • 81. 81• 699 pacientes (electrosurgical)• Doença residual: 38 pacientes (5.4%)Doença residual pós conizaçãoGynecol Oncol 2002 Apr;85(1):119-24Costa S, De Nuzzo M, Infante FE, Bonavita B, Marinelli M,Rubino A, Rambelli V, Santini D, Cristiani P, Bucchi L.• Idade da paciente• Período de tempo• Tamanho da lesão• Síto da lesão• Grau do NIC• Tamanho do cone• Profundidade do cone• Margens CirúrgicasNenhum destes fatores influenciou
  • 82. 82• 79 cones pacientes com NIC IIIDoença residual pós conizaçãoGynecol Oncol 2001 Jul;82(1):177-80Jain S, Tseng CJ, Horng SG, Soong YK, Pao CC.• Margens positivas47(59,5%)• DNA HPVPOS 37 (78,7%)NEG 10 (21,3%)Doença residual:31/47 pacientes (66%)Não houve Doença Residual:Nos casos HPV NEG
  • 83. 83• 79 cones pacientes com NIC IIIDoença residual pós conização• Margens negativas32(59,5%)• DNA HPVPOS 7 (22%) *NEG 25 (78%)* Doença residual:1/7Gynecol Oncol 2001 Jul;82(1):177-80Jain S, Tseng CJ, Horng SG, Soong YK, Pao CC.
  • 84. 84Sensibilidade:PAP: 62% DNA-HPV: 90%• Valor Preditivo Negativo(PAP normal + HPV Negativo) : 99 %Alex Ferenczy, Quebec,Florianópolis 2001Doença residual pós conização• 184 Mulheres• NIC II/III Pós Cone• Doença Residual – 29 (15,8%)
  • 85. 85Revisão de 9 estudos de recorrência de LIE pósconeJack Cuzick – London,England, Florianópolis 2001Doença residual pós conização 90-100% destes casos são HPV (+) Mulheres HPV (-) provavelmente nãoterão doença recorrente
  • 86. 861. O DNA-HPV no CA SITU” (NIC III) é o melhorindicador de doença residual pós cone, identificando adoença que irá progredir2. Teste de DNA-HPV:• Sensibilidade elevada• Valor Preditivo Negativo elevado• Deve ser utilizado no controle terapêutico3. Margens Cirúrgicas:• Não têm Valor PreditivoAlex Ferenczy, Quebec, Forianópolis 2001Doença residual pós conização
  • 87. 87http://www.aepcc.org/congreso/pdf/CONS-VPH.pdf
  • 88. 881. Prevalência alta2. Mortalidade alta3. Evolução crônica4. Pode ser detectado em uma fase precoce5. Pode ser tratado em uma fase precoceCâncer do colo do útero
  • 89. 89Por que?É possível? De que forma?Prevenção do câncer do colouterino
  • 90. 90De que forma?Prevenção do câncer do colouterino
  • 91. 911. Detecta atipias celulares,2. Alteração compatível com LIE: a paciente ésubmetida à colposcopia e biópsia dirigidaCitologia1. Seleciona casos que podem evoluir para NIC II ouIII, afastando os que não evoluirão, funcionandocomo marcador de NIC III (ZIELINSKI D.G, et al.,2001; CUZICK, 2001).2. Controle terapêutico para doença residual pós-cone.Teste de DNA?
  • 92. 92
  • 93. 93• Pequenos• Oncogênicos• Livres delipídios• Similares àMicroscopiaEletrônica Os Papilomavírus são encontrados em animaismamíferos e em somente uma espécie de ave: o tentilhão.
  • 94. 94Family orUnassigned genusNatureof thegenomePresenceof anenvelopeMorphology GenomeConfigurationGenomeSize kbpor kbHostIridoviridae dsDNA - isometric 1 linear 140-383 Vertebrates/InvertebratesPhycodnaviridae dsDNA - isometric 1 linear 160-380 AlgaeBaculoviridae dsDNA + bacilliform 1 circularsupercoiled80-180 InvertebratesHerpesviridae dsDNA + isometric 1 linear 125-240 VertebratesAdenoviridae dsDNA - isometric 1 linear 28-45 VertebratesRhizidiovirus dsDNA - isometric 1 linear 27 FungiPolyomaviridae dsDNA - isometric 1 circular 5 VertebratesPapillomaviridae dsDNA - isometric 1 circular 7-8 VertebratesPolydnaviridae dsDNA + rod, fusiform multiplesupercoiled150-250 InvertebratesAscoviridae dsDNA + reniform 1 linear 100-180 InvertebratesInoviridae ssDNA - filamentous 1 + circular 7-9 Bacteria, MycoplasmasMicroviridae ssDNA - isometric 1 + circular 4-6 Bacteria, Spiroplasmas
  • 95. 95Papovaviridae - Papovaviruses ICTV - Datas Links! TutorialFamily Genus EM Images Example Virus Diseases Polyomavirus N/A murine polyomavirusN/A Rabbit (Shope) Papillomavirusan animal papillomavirusmultiple human papillomavirusesa human papillomavirusa human papillomavirusA model of the papillomavirus capsid is shown beside acomputer colorized EM image.PapovaviridaePapillomavirusa human papillomavirus
  • 96. 96 Papilomavírus  Polyomavírus “Vacuolatingvírus" (SV 40)Melnich PAPOVAVÍRUS :
  • 97. 97 1973 The International Committee on Nomenclature ofViruses (ICNV) se transformou em International Committeeon Taxonomy of Viruses (ICTV). Hoje o ICTV opera sob asauspícios da Virology Division of the International Union ofMicrobiological Societies.O ICTV tem 6 Subcomitês, 45Grupos de Estudo, e 400 virologistas participantes.1966 The International Committee on Nomenclature ofViruses (ICNV) foi estabelecido no International Congress ofMicrobiology in Moscow
  • 98. 98
  • 99. 99Human papillomavirus type 16,complete genome [1..1000]
  • 100. 100PRIMERS DE L1 (My09 e My11) 6583-6602/7015-7034 (GP5+ e GP6+) 6624-6649/6719-67466541 TCTATCCC AAATATTCAA TAAACCTTAT TGGTTACAAC GAGCACAGGG CCACAATAATAGATACGGG TTTATAAGTT ATTTGGAATA ACCAATGTTG CTCGTGTCCC GGTGTTATTA6601 GGCATTTGTT GGGGTAACCA ACTATTTGTT ACTGTTGTTG ATACTACACG CAGTACAAATCCGTAAACAA CCCCATTGGT TGATAAACAA TGACAACAAC TATGATGTGC GTCATGTTTA6661 ATGTCATTAT GTGCTGCCAT ATCTACTTCA GAAACTACAT ATAAAAATAC TAACTTTAAGTACAGTAATA CACGACGGTA TAGATGAAGT CTTTGATGTA TATTTTTATG ATTGAAATTC6721 GAGTACCTAC GACATGGGGA GGAATATGAT TTACAGTTTA TTTTTCAACT GTGCAAAATACTCATGGATG CTGTACCCCT CCTTATACTA AATGTCAAAT AAAAAGTTGA CAGTTTTAT6781 ACCTTAACTG CAGACGTTAT GACATACATA CATTCTATGA ATTCCACTAT TTTGGAGGACTGGAATTGAC GTCTGCAATA CTGTATGTAT GTAAGATACA TAAGGAGATA AAACCTCCTG6841 TGGAATTTTG GTCTACAACC TCCCCCAGGA GGCACACTAG AAGATACTTA TAGGTTTGTAACCTTAAAAC CAGATGTTGG AGGGGGTCCT CCGTGTGATC TTCTATGAAT ATCCAAACAT6901 ACCCAGGCAA TTGCTTGTCA AAAACATACA CCTCCAGCAC CTAAAGAAGA TGATCCCCTTTGGGTCCGTT AACGAACAGT TTTTGTATGT GGAGGACGTG GATTTCTTCT ACTAGGGGAA6961 AAAAAATACA CTTTTTGGGA AGTAAATTTA AAGGAAAAGT TTTCTGCAGA CCTAGATCAGTTTTTTATGT GAAAAACCCT TCATTTAAAT TTCCTTTTCA AAAGACGTCT GGATCTAGTC7021TTTCCTTTAG GACGCAAATT TTTACTACAA GCAGGATTGA AGGCCAAACC AAAATTTACAAAAGGAAATC CTGCGTTTAA AAATGATGTT CGTCCTAACT TCCGGTTTGG TTTTAAATGT
  • 101. 101MY 09/11GP5+/6+ RFLP• Controles +/-• HPV +/-• ß globina (casos 1 e 2 )• HPV +/-• Água + ß globina• HPV – (contr) + MY
  • 102. 102• Digestão enzimática e análisepelo polimorfismo dostamanhos dos fragmentos derestrição• Sete enzimas de restrição:Bam H1, Dde I, Hae III, Hinf I,Pst I, Rsa I e Sau3AIBERNARD et al.(1994)RFLP
  • 103. 103Marcos Históricos
  • 104. 104Primeiras observações• 1907 - Ciuffo : Afirma que as Verrugas da pele têmEtiologia Viral (auto-inoculação)• 1924 - Serra confirma a Etiologia Viral das VerrugasGenitais retirando extratos filtrados de condiloma depênis para produzir verrugas genitais em voluntários• 1933 – Richard Shope isolou o PV de coelhos selvagensmostrando que Papilomas podem ser causados poragentes filtrados transmitidos através da peleescarificada
  • 105. 105 1949 Teoria Unicista- (Microscopia Eletrônica) : Condições benignas,Verrugas de Pele e Genitais e Papiloma de Laringeteriam o mesmo agente etiológico. 1969 Teoria Pluralista- Almeida e col (Imunomicroscopia Eletrônica) :Diferenças antigênicas entre vírus das VerrugasGenitais dos presentes em Verrugas de Pele,embora houvesse cruzamentos antigênicos.Teorias sobre a natureza do vírus
  • 106. 106Meados de 1970Zur Hausen - Sugere associaçãoentre HPV e Câncer Genital• Zur Hausen H. Condylomata acuminata and human genital cancer.Cancer Res 1976:36:530.• Meisels A. Fortin R. Condylomatous lesions of the cervix and.vagina. I. Cytologic patterns. Acta Cytol 1976;20:505.• Purola E, Savia E. Cytology of gynecologic condyloma.acuminatum. Acta Cytol 1977;21:26.
  • 107. 107 Hibridização Molecular (e Endonucleases de Restrição)entre extratos de diferentes lesões verrucosas : DNAs de condilomas genitais e verrugas laríngeas nãose hibridizavam .1974Vírus de diferentes lesõesverrucosas são diferentes
  • 108. 1081976-1977Estudos epidemiológicosImplicam o HPV na etiologia docâncer genital.• Kessler IL. Human cervical cancer as a venereal disease.Cancer Res 1976;36:783• Zur Hausen H. Human papillomaviruses and their possiblerole in squamous cell carcinomas.Curr Top Microbiol Immunol 1977;78:1.
  • 109. 1091978Primeiros estudos comMicroscopia EletrônicaDella Torre G, Pilotti S, De Palo G, Rilke F. Viral particles incervical condylomatous lesions. Tumori 1978;64:549.Hills E, Laverty CR. Electron microscopic detection of papillomavirus particles in selected koilocytotic cells in a routine cervicalsmear.Acta Cytol 1979;23:53.
  • 110. 110
  • 111. 111• 1981 - Viliens e col produziram o primeiro clone deDNA de HPV, HPV-6, extraído de verrugas genitais.• 1982 - Gissmann e col Extraíram o HPV-11 depapiloma de laringe. Foi também extraído decondilomas acuminados genitais e "BuschkeLowenstein tumors".• 1983 - Detectado HPV-16 de cânceres cervicais(61,1%), doença de Bowen e papulose bowenóide .Anos 80Primeiras seqüências genéticas:HPV 6 HPV 11 HPV 16
  • 112. 1121983Zur Hausen - Identifica os HPVs16 e 18 em 70% dos cânceres cervicais.• Durst M, Gissmann L, Idenburg H, Zur Hausen H.A papillomavirus DNA from a cervical carcinoma and itsprevalencein cancer biospy samples from different geographicregions.Proc Natl Acad Sci USA 1983;80:3812.• Boshart M, Gissman L, Ikenberg H, Kleinheinz A, Scheurlen.W, Zur Hausen H. A new tipe of papillomavirus DNA, its presence.in genital cancer biopsies and in cell lines derived from cervicalcancer. EMBO J. 1984;3:1151.
  • 113. 113• Prevalence of Human Papillomavirus in Cervical Cancer: AWorldwide Perspective[J Natl Cancer Inst 87:796-802, 1995]F. Xavier Bosch, M. Michele Manos, Nubia Muñoz, MarkSherman, Angela M. Jansen, Julian Peto, Mark H. Schiffman,Victor Moreno, Robert Kurman, Keerti V. Shah, InternationalBiological Study on Cervical Cancer (IBSCC) Study Group1995Evidências Epidemiológicas daEtiologia Viral do CâncerF.X.Bosch,Barcelona,Espanha International Agency for Research on Cancer (IARC) ispart of the World Health Organization
  • 114. 114
  • 115. 115Tipos Virais
  • 116. 116Papillomavirus infections--a major cause of human cancers.Zur Hausen H Deutsches Krebsforschungszentrum, Heidelberg,Germany.Biochim Biophys Acta 1996 Oct 9;1288(2):F55-781996 77 tipos de HPV haviam sidoidentificados Estima-se que mais de 30,000 vírus estejam sendoestudados em diversos laboratórios do mundo Hoje, o ICTV reconhece mais de 3.600 espécies de vírus.
  • 117. 117 1976 - 4 1980- 6 1982- 13 1983- 24ftp://ftp-t10.lanl.gov/pub/papilloma/GenBank-files/Human-papillomahttp://hpv-web.lanl.gov/stdgen/virus/hpv/http://www.ncbi.nlm.nih.gov/genomes/VIRUSES/151340.html 1986- 40 1989- 60 1997- 77 2004- 83 2005- 100Tipos de HPV
  • 118. 118http://www.aepcc.org/congreso/pdf/CONS-VPH.pdf
  • 119. 11923 tipos ano-genitais• Alto risco : 16, 18, 31, 33, 35, 39, 45, 51,52,56, 58, 59, 68• Baixo Risco : 6, 11, 42, 43, 44Advance for Administrators of theLaboratory , May 2001, Vol.10 N.05 P.69David A Baunoch, PhD
  • 120. 120 Somente determinados tipos de HPV sãoligados ao câncer cervical. Estes sãochamados de alto risco. Os tipos de HPV que causam verrugagenital externa elevada não estão associadosao câncer. Estes são chamados de baixorisco.Advance for Administrators of theLaboratory , May 2001, Vol.10 N.05 P.69David A Baunoch, PhD
  • 121. 121Diferença entre os gruposde alto e baixo riscoPapel transformante dos produtosdos genes E6 e E7 (oncoproteínas)• Advance for Administrators of theLaboratory , May 2001, Vol.10 N.05P.69.Helt AM e col.• J Virol 2002 Oct;76(20):10559-68David A Baunoch
  • 122. 122Gene: Function:E1 Initiation of DNA replicationE2 Transcriptional regulation/DNA replicationE3 ???E4 Disrupts cytoskeleton?E5 Transforming protein, interacts with growth factor receptorsE6 Transforming protein, binds to p53 leading to degradationE7 Transforming protein, binds to pRBE8 ???L1 Major capsid proteinL2 Minor capsid protein
  • 123. 123http://www.aepcc.org/congreso/pdf/CONS-VPH.pdf
  • 124. 124http://www.aepcc.org/congreso/pdf/CONS-VPH.pdf
  • 125. 125GenesE6/E7OncoproteínasCodificamP53,RbInativamImortalizaçãoda célulaProteínas supressorasdo Câncer
  • 126. 126F.X.Bosch IARC , Florianópolis 2001Mulheres com CA50-60 %10-12 %4.5 %Mulheres sem Lesão20 %10 %8 %Prevalência:Tipo161831/45
  • 127. 127 10, 3% de mulheres da populaçãobrasileira são HPV-DNA positivasASCO - American Society of Clinical Oncology, 1438-1999Cunha F et al. 1999• Estudo com 1501 mulheres sem históriaanterior de LIE (PCR)• Idade média = 35 anosPrevalência no Brasil:
  • 128. 128Positividade de DNA HPVconforme o métodoBosch, FlorianópolisMétodo• FISH• Dot Blot• Southern Blot• PCR (MY 09/11)• PCR (GP 5+/6+)• TS E7 , E1, CPI/IICâncer 93-100 30-40 25-36 70-75 90-95 100Controle• 0-63• 1-3• 4-6• 5-15• 5-20
  • 129. 129
  • 130. 130Muito obrigadoPaulo Newton Danzi SalviaMédico Anátomo Patologistapaulo@citocamp.com.brwww.citocamp.com.br

Related Documents