Universidad Central de Venezuela Facultad de Medicina Escuela de BioanálisisLaboratorio de Inves...
INTRODUCCIÓN INTERACCIONES EN EL DESARROLLO DEL SM PREDISPOSICIÓN GENÉTICA ...
RECEPTORES ACTIVADOS PORPROLIFERADORES DE PEROXISOMAS PPARS ...
POLIMORFISMO PRO12ALA PRO12PRO Codón 12 ATG GGT GA...
METODOLOGÍA POBLACIÓN  Pacientes entre 2 y 12 años que acuden al Triaje y a la consulta...
METODOLOGÍAEXTRACCIÓN DESANGRE VENOSA EXTRACCIÓN DE ADN P...
EXTRACCIÓN DE SANGRE VENOSASin Anticoagulante Con Anticoagulant...
Amplificado de 102 pb. Gen de PPARɣ2 PCR RFLP ...
ELECTROFORESIS EN GEL DE POLIACRILAMIDA 2% Y TINCIÓN CON ...
RESULTADOS Tabla Nº 1: Características fenotípicas de los sujetos en estudio. ...
RESULTADOS Tabla Nro. 2: Comparación de los diferentes genotipos de PPARγ2 en niñosobesos con respecto al grupo control. ...
RESULTADOS Tabla Nro. 3: Comparación de los diferentes genotipos de PPARγ2 en niñosresistentes a la insulina con respecto...
RESULTADOS Tabla Nro. 3: Comparación de los diferentes genotipos de PPARγ2 en niñoshipercolesterolemicos con respecto al ...
RESULTADOS Comparación de los diferentes genotipos de PPARγ2 en niños hipertrigliceridemicos con respecto...
RESULTADOS• Tabla N°2: Distribución de frecuencia de los polimorfismos de PPARɣ2 de acuerdo a los grupos en estudio. ...
CONCLUSIONESSe observó una mayor susceptibilidad adesarrollar obesidad, resistencia a lainsulina e hipercolesterolemia en ...
CONCLUSIONESSe recomienda la ampliación de esteestudio aumentando el tamaño de lamuestra, para evaluar si semantienen las ...
POLIMORFISMO PRO12ALA DEL GEN PPARγ-2 EN NIÑOS CON SUSCEPTIBILIDAD A DESARROLLAR SINDROME METABÓLICO
of 18

POLIMORFISMO PRO12ALA DEL GEN PPARγ-2 EN NIÑOS CON SUSCEPTIBILIDAD A DESARROLLAR SINDROME METABÓLICO

La obesidad infantil es una enfermedad metabólica con una tasa de prevalencia en aumento en el mundo, constituye un factor de riesgo para el desarrollo de enfermedades crónicas no transmisibles. El síndrome metabólico es un conjunto de alteraciones metabólicas y cardiovasculares que se producen como consecuencia de la resistencia a la insulina, que a su vez tiene un alto grado de relación con la obesidad. Por tal motivo es posible observar como una enfermedad está concatenada con el desarrollo de otras. Sin embargo el origen real de todas ellas se encuentra en la conjugación de la predisposición genética y de los factores ambientales del individuo.Los PPARS son Receptores de ubicación nuclear Controlan la expresión de genes que regulan el metabolismo lipídico, glucídico y la proliferación y diferenciación celular en los distintos tejidos del cuerpo. También están involucrados en el metabolismo y almacenamiento de ácidos grasos. Son activados por compuestos que hacen proliferar los peroxisomas y a esto le deben su nombre.
Published on: Mar 4, 2016
Published in: Health & Medicine      
Source: www.slideshare.net


Transcripts - POLIMORFISMO PRO12ALA DEL GEN PPARγ-2 EN NIÑOS CON SUSCEPTIBILIDAD A DESARROLLAR SINDROME METABÓLICO

  • 1. Universidad Central de Venezuela Facultad de Medicina Escuela de BioanálisisLaboratorio de Investigaciones Básicas y Aplicadas Autor: Br. Laura Noguera
  • 2. INTRODUCCIÓN INTERACCIONES EN EL DESARROLLO DEL SM PREDISPOSICIÓN GENÉTICA FACTORES AMBIENTALES 1 • Propia del individuo • Contexto cultural–social • Mayor tendencia de desarrollar • Sedentarismo ciertas patologías • Mala alimentación DESORDENES METABÓLICOS Conjunto de alteraciones metabólicas y cardiovasculares que se producen como consecuencia de RI y se caracteriza por: Hipertensión Resistencia Hipercolesterolemia Obesidad Arterial a la Insulina1. Amigo H. Cad. Sáude Púb. 2003;19(1): 163- 170
  • 3. RECEPTORES ACTIVADOS PORPROLIFERADORES DE PEROXISOMAS PPARS RECEPTORES DE UBICACIÓN NUCLEAR • Controlan la expresión de genes que regulan el metabolismo lipídico, glucídico y la proliferación y diferenciación celular. • Involucrados en el metabolismo y almacenamiento de ácidos grasos en diferentes tejidos. • Son activados por ligandos: NATURALES (Ac. Grasos y eicosanoides) SINTÉTICOS (Fibratos y TZD) PPARα PPARβ/δ PPARγ Alta taza de Todos los tejidoscatabolismo de Ac. Alta expresión en Grasos tejido adiposo Localizado en el brazo-Músculo esquelético corto del cromosoma 3 PPARγ1 - Corazón (3p25) - Corteza renal Abundante en el - Hígado tejido adiposo, en el que induce diferenciación de PPARγ2 adipocitos PPARγ3
  • 4. POLIMORFISMO PRO12ALA PRO12PRO Codón 12 ATG GGT GAA ACT CTG GGA GAT TCT CCT ATT GAC CCA GAA AGC Prolina El receptor PPARγ 2 Pro12Pro es un receptor activado por proliferadores de peroxisomas, el cual protege contra la ubicación de la grasa ectópica. PRO12ALAATG GGT GAA ACT CTG GGA GAT TCT CCT ATT GAC GCA GAA AGC Alanina Estudios epidemiológicos han sugerido la existencia de una asociación entre el polimorfismo Pro12Ala en el exón B del receptor PPARγ2, obesidad y otras alteraciones metabólicasrelacionadas con el Síndrome Metabólico2,3. Los resultados no han sido siempre concordantes. 2. Beamer B, y cols. Diabetes 1998;47:1806-1808. 3. Frederiksen L, y cols. J Clin Endocrinol Metab 2002;87:3989-3992.
  • 5. METODOLOGÍA POBLACIÓN  Pacientes entre 2 y 12 años que acuden al Triaje y a la consulta deobesidad del Centro de Atención Nutricional Infantil de Antímano (CANIA) y el Servicio de Nutrición, Crecimiento y Desarrollo del Hospital de Niños “JM de Los Ríos” MUESTRA  235 individuos, clasificados de la siguiente manera: 31 9 13,20% 92 3,83% 39,14% 48 Obesos 20,42% RI Hipercolesterolémicos 23,40% Hipertrigliceridémicos Sanos 55
  • 6. METODOLOGÍAEXTRACCIÓN DESANGRE VENOSA EXTRACCIÓN DE ADN PCR RFLP
  • 7. EXTRACCIÓN DE SANGRE VENOSASin Anticoagulante Con Anticoagulante • Determinación de Glicemia, Colesterol EXTRACCIÓN DE Total y Triglicéridos ADN • Insulina Método de Bunce Modificado • Electroforesis de Colesterol Cuantificación de ADN PCR Amplificado de 102 pb. Gen de PPARɣ2 Figura Nº 1: Electroforesis en gel de agarosa al 2 %, coloreado con BrEt. Cámara digital, equipo Uvitec (Gel Documentation Uvitec Limited).
  • 8. Amplificado de 102 pb. Gen de PPARɣ2 PCR RFLP GCGC Digestión con enzima Hha I CORTE COHESIVO CGCG 5’TCTGGGAGATTCTCCTATTGGC-3’ Primer F Mish-mash 5’TCTGGGAGATTCTCCTATTGACCCAGAAAGCGATTCCTTCACTGATACACTGT GENOTIPO PRO12PRO CTGCAAACATATCACAAGGTAAAGTTCCTTCCAGATACGGCTATTGGGG-3’ Primer R 5’CCTTCCAGATACGGCTATTGGGG-3’ 5’TCTGGGAGATTCTCCTATTGGC-3’ Primer F Permite el corte de la Ez. Hha I 5’TCTGGGAGATTCTCCTATTGGCGCAGAAAGCGATTCCTTCACTGATACACTGT POLIMORFISMO PRO12ALA CTGCAAACATATCACAAGGTAAAGTTCCTTCCAGATACGGCTATTGGGG-3’ Primer R 5’CCTTCCAGATACGGCTATTGGGG-3’
  • 9. ELECTROFORESIS EN GEL DE POLIACRILAMIDA 2% Y TINCIÓN CON NITRATO DE PLATA Genotipo Polimorfismo PRO12PRO PRO12ALA Fragmento de Fragmentos de 102 pb. restricción de: La enzima NO 80pb. CORTA 22pb.Figura Nº 3: Producto de digestión del fragmento amplificado por PCR, con la enzima de restricción HhaI. En la fotografía se muestra la electroforesis en gel de poliacrilamida al 2% coloreado con Nitrato de Plata. 1) Marcador de peso molecular DNA ladder de 25pb 2) producto de PCR sin digerir. 3) Control negativo 4) Control Pro12Ala. 5) Portador Pro12Pro. 6) Portador del polimorfismo Pro12Ala.
  • 10. RESULTADOS Tabla Nº 1: Características fenotípicas de los sujetos en estudio. Control Obesos (n=92) RI (n=55) HC (n=48) HT (n=9) (n=31) Glucosa 88,17±11,58* 93,43±13,63* 88,67±14,07* 92,03±13,33* 81,59±12,63Insulina 27,73±40,11* 17,92±10,81* 12,39±10,48* 13,01±4,23* 4,42±1,22Colesterol 167±32,45* 176,28±33,76* 205,91±21,92* 187,90±34,97* 122,28±25,41 total LDL-c 106,60±28,41* 113,15±31,55* 137,82±26,94* 113,92±31,83* 70,53±16,33 HDL-c 38,07±10,72 38,84±10,07 42,88±11,21 37,90±9,6 40,48±10,37 TAG 109,76±95,63* 111,38±51,31* 117,47±95,18* 180,03±49,42* 54,57±29,29
  • 11. RESULTADOS Tabla Nro. 2: Comparación de los diferentes genotipos de PPARγ2 en niñosobesos con respecto al grupo control. Obesos Control P % (n=92) %(n=31) Genotipo PPARγ Pro12Pro 83,7 (77) 93,6 (29) ns Pro12Ala 16,3 (15) 6,4 (2) ns OR= 2,8 IC 95% = 0,6 – 19,1
  • 12. RESULTADOS Tabla Nro. 3: Comparación de los diferentes genotipos de PPARγ2 en niñosresistentes a la insulina con respecto al grupo control. RI Control P % (n=55) %(n=31) Genotipo PPARγ Pro12Pro 85,5 (47) 93,6 (29) ns Pro12Ala 14,5 (8) 6,4 (2) ns OR= 2,5 IC 95% = 0,4 – 18,1
  • 13. RESULTADOS Tabla Nro. 3: Comparación de los diferentes genotipos de PPARγ2 en niñoshipercolesterolemicos con respecto al grupo control. HC Control P % (n=48) %(n=31) Genotipo PPARγ Pro12Pro 85,4 (41) 93,6 (29) ns Pro12Ala 14,6 (7) 6,4 (2) ns OR= 2,5 IC 95% = 0,4 – 18,7
  • 14. RESULTADOS Comparación de los diferentes genotipos de PPARγ2 en niños hipertrigliceridemicos con respecto al grupo control. HT Control P % (n=9) %(n=31) Genotipo PPARγ Pro12Pro 88,9 (8) 93,6 (29) ns Pro12Ala 11,1 (1) 6,4 (2) ns OR= 1,8 IC 95% = 0,1 – 31,9
  • 15. RESULTADOS• Tabla N°2: Distribución de frecuencia de los polimorfismos de PPARɣ2 de acuerdo a los grupos en estudio. Grupo Obesos RI HT HC Control TOTAL (n=92) (n=55) (n=9) (n=48) (n=31) % n % 83,7 85,5 88,9 85,4 93,6 Pro12Pro 202 86,0 (77) (47) (8) (41) (29) 16,3 14,5 11,1 14,6 6,4 Pro12Ala 33 14,0 (15) (8) (1) (7) (2) TOTAL 100 100 100 100 100 235 100
  • 16. CONCLUSIONESSe observó una mayor susceptibilidad adesarrollar obesidad, resistencia a lainsulina e hipercolesterolemia en losportadores del alelo Pro12Ala del genPPAR2, sin embargo no existen diferenciasestadísticamente significativas con respecto ala presencia del alelo Pro12Ala con dichasenfermedades.
  • 17. CONCLUSIONESSe recomienda la ampliación de esteestudio aumentando el tamaño de lamuestra, para evaluar si semantienen las tendencias descritasen el presente estudio.

Related Documents