geneticists Association
e 2013 Dublin
Polyploidy: ancient andPolyploidy: ancient and
modern signatures inmodern signatures...
Recent polyploidy
◦ Revealed by cytogenetics and hybridization
Recent rearrangements or duplications
◦ Revealed by molec...
DasypyrumDasypyrum
breviaristatumbreviaristatum
2n=4x=282n=4x=28
Is itIs it AAAAAAAA oror AAAABB??
D. villosum (genomic
DN...
Wheat evolution and hybridsWheat evolution and hybrids
Triticum uratu
2n=2x=14
AA
Einkorn
Triticum monococcum
2n=2x=14
AA
...
Satellite DNA probe green
Evolution of Wheats - PolyploidyEvolution of Wheats - Polyploidy
Common Ancestor
2n=2x=14
Aegilops ventricosa
2n=4x=28
DDN...
Lodging in cereals
Use of repetitiveUse of repetitive
DNA sequences asDNA sequences as
chromosomechromosome
markersmarkers
Aegilops tauschiiAegilops tauschii in Iranin Iran
Dpta1
dpTa1-
Repetitive
banding pattern
does correlate
with taxonomic
gr...
Copyright restrictions may apply.
Saeidi, H. et al. Ann Bot 2008 101:855-861; doi:10.1093/aob/mcn042
UPGMA dendrograms of ...
Wild diploid bananaWild diploid banana
Cavendish : ‘Western’
banana cultivar
2n=3x=33;
AAA genomes
RetroelementsRetroelements
Sequences which amplify through an RNASequences which amplify through an RNA
intermediateinterm...
Alignment of two BACs shows gaps in both A and B genome
MA4_82I11
MBP_81C12
MuhAT
1
MuhAT2
a
XX TE (SINGLE)XX TE MITE
XX T...
RetroelementsRetroelements
Homologous BAC sequences from Calcutta
4 Homologous over the full length
except for a 5kb ins...
01/07/13 19
Sr. No. Primer Pairs Product Size
(bp)
Sequence
1. hAT18486
hAT19037
560 ACCCACCTGGCTCTTGTGTC
AGCGAATGTGTTTTGA...
01/07/13 20
Sr. No. Primer Pairs Product Size
(bp)
Sequence
1. hAT18486
hAT19037
560 ACCCACCTGGCTCTTGTGTC
AGCGAATGTGTTTTGA...
A-genome specific hAT in three
Musa hybrids (2n=3x=33)
Musa ‘Williams Cavendish’
(AAA)
Musa
(ABB)
Musa
(ABB)
01/07/13 22
Dot plot showing the complete Inverted
repeat.
01/07/13 23
HP-1 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 ...
Retroelement Markers
Retrotransposon
LTRLTR
Retrotransposon
LTRLTR
RetrotransposonLTR LTR
Retrotransposon
LTRLTR
Insertion...
IRAP diversity in MusaIRAP diversity in Musa
Teo, Tan, Ho, Faridah, Othman, HH, Kalendar, Schulman 2005 J Plant Biol
Nair,...
01/07/13 26Phylogenetic analysis of Musa genomes – separating species. Teo, Schwarzacher et al.
Diploid 2n=2x=22 Musa / banana metaphase probed red with transposable element
Timing of LTR Retrotransposon insertion in Musa
Red 0 to 2 Mya, yellow 2 to 4 Mya, green 4 to 6 Mya and blue older
D’Hont ...
The Banana GenomeThe Banana Genome
Seven countries + international organization
coordinated by Angelique D’Hont - France
...
523 Mb DH-Pahang genome size (flow
cytometry)
27.5 million Roche/454 single reads 16 x
coverage
2.1 million Sanger read...
A D’Hont et al. Nature 000, 1-5 (2012) doi:10.1038/nature11241
Six-way Venn diagram showing the distribution of shared gen...
A D’Hont et al. Nature 000, 1-5 (2012) doi:10.1038/nature11241
Whole-genome duplication events.
A D’Hont et al. Nature 2012
doi:10.1038/nature11241
A D’Hont et al. Nature 2012
doi:10.1038/nature11241
1010 µµmm
DNA methylation is unevenly distributed onDNA methylation is unevenly distributed on
MusaMusa chromosomeschromos...
1010 µµmm
C.H Teo and Schwarzacher
5MeC
DNA methylation is unevenly distributed onDNA methylation is unevenly distributed ...
Arachis hypogaeaArachis hypogaea - Peanut- Peanut
Tetraploid of recent origin,Tetraploid of recent origin,
ancestors separ...
A2n=4x=40probed
(A.duranered)A.ipaënsis

Be
Arachis duranensis BAC probes on A.
hypogea chromosomes
Right: green BAC AD52G19;red AD79O23
Below: red AD51I17
Below righ...
paradox in the evolution of genome
structure: the predominant repetitive DNA
genome fraction is in evolutionary flux,
whi...
Size and location of
chromosome regions
from radish (Raphanus
sativus) carrying the
fertility restorer Rfk1
gene and trans...
Recent polyploidy
◦ Revealed by cytogenetics and hybridization
Recent rearrangements or duplications
◦ Revealed by molec...
Anything special about cropAnything special about crop
genomes?genomes?
Crop Genome size 2n Ploidy Food
Rice 400 Mb 24 2 3...
50 years of plant breeding50 years of plant breeding
progressprogress
Global production figuresGlobal production figures
A...
CytoGenomics …CytoGenomics …
The genepool has the
diversity to address these
challenges …
New methods to exploit and
cha...
www.molcyt.comwww.molcyt.com
phh4@le.ac.ukphh4@le.ac.uk
Recent polyploidy
◦ Revealed by cytogenetics and hybridization
R...
geneticists Association
e 2013 Dublin
Polyploidy: ancient andPolyploidy: ancient and
modern signatures inmodern signatures...
Polyploidy and molecular cytogenetics in crops: ECA conference Dublin July 2013
Polyploidy and molecular cytogenetics in crops: ECA conference Dublin July 2013
Polyploidy and molecular cytogenetics in crops: ECA conference Dublin July 2013
Polyploidy and molecular cytogenetics in crops: ECA conference Dublin July 2013
Polyploidy and molecular cytogenetics in crops: ECA conference Dublin July 2013
Polyploidy and molecular cytogenetics in crops: ECA conference Dublin July 2013
Polyploidy and molecular cytogenetics in crops: ECA conference Dublin July 2013
Polyploidy and molecular cytogenetics in crops: ECA conference Dublin July 2013
of 51

Polyploidy and molecular cytogenetics in crops: ECA conference Dublin July 2013

Published on: Mar 4, 2016
Published in: Education      Technology      
Source: www.slideshare.net


Transcripts - Polyploidy and molecular cytogenetics in crops: ECA conference Dublin July 2013

  • 1. geneticists Association e 2013 Dublin Polyploidy: ancient andPolyploidy: ancient and modern signatures inmodern signatures in karyotypes of crops andkaryotypes of crops and breeding materialbreeding material Pat Heslop-Harrison Phh4@le.ac.uk Website: www.molcyt.com or www.molecularcytogenetics.com UserID/PW ‘visitor’ To download full text of papers
  • 2. Recent polyploidy ◦ Revealed by cytogenetics and hybridization Recent rearrangements or duplications ◦ Revealed by molecular cytogenetics Ancient, evolutionary polyploidy ◦ Revealed by sequencing Understanding polyploidy is important for speciation, evolution and breeding Different sequence classes evolve at different rates and many are saltatory rather than clocks Consequences and applications
  • 3. DasypyrumDasypyrum breviaristatumbreviaristatum 2n=4x=282n=4x=28 Is itIs it AAAAAAAA oror AAAABB?? D. villosum (genomic DNA green) × D. breviaristatum (red) Meiotic metaphase I in a F1 hybrid showing autotetraploid nature Galasso et al.
  • 4. Wheat evolution and hybridsWheat evolution and hybrids Triticum uratu 2n=2x=14 AA Einkorn Triticum monococcum 2n=2x=14 AA Bread wheat Triticum aestivum 2n=6x=42 AABBDD Durum/Spaghetti Triticum turgidum ssp durum 2n=4x=28 AABB Triticum dicoccoides 2n=4x=28 AABB Aegilops speltoides relative 2n=2x=14 BB Triticum tauschii (Aegilops squarrosa) 2n=2x=14 DD Triticale xTriticosecale 2n=6x=42 AABBRR Rye Secale cereale 2n=2x=14 RR
  • 5. Satellite DNA probe green
  • 6. Evolution of Wheats - PolyploidyEvolution of Wheats - Polyploidy Common Ancestor 2n=2x=14 Aegilops ventricosa 2n=4x=28 DDNN Triticum tauschii 2n=2x=14 DD Aegilops uniaristata 2n=2x=14 NN Triticum aestivum 2n=6x=42 AABBDD Triticum durum 2n=4x=28 AABB Triticum monococcum 2n=2x=14 AA Aegilops sp. 2n=2x=14 BB Aegilops 2n=2x=14 Triticum 2n=2x=14
  • 7. Lodging in cereals
  • 8. Use of repetitiveUse of repetitive DNA sequences asDNA sequences as chromosomechromosome markersmarkers
  • 9. Aegilops tauschiiAegilops tauschii in Iranin Iran Dpta1 dpTa1- Repetitive banding pattern does correlate with taxonomic grouping
  • 10. Copyright restrictions may apply. Saeidi, H. et al. Ann Bot 2008 101:855-861; doi:10.1093/aob/mcn042 UPGMA dendrograms of the relationships based on IRAP analysis of (A) accessions of Ae. tauschii subsp
  • 11. Wild diploid bananaWild diploid banana Cavendish : ‘Western’ banana cultivar 2n=3x=33; AAA genomes
  • 12. RetroelementsRetroelements Sequences which amplify through an RNASequences which amplify through an RNA intermediateintermediate 50% of all the DNA!
  • 13. Alignment of two BACs shows gaps in both A and B genome MA4_82I11 MBP_81C12 MuhAT 1 MuhAT2 a XX TE (SINGLE)XX TE MITE XX TE (AGNABI) MuhAT3 MuhAT4 MITE(MBIR ) XX TE XX TE (MBT) 272 bp 102,190 bp 26, 410 bp 128,068 bp DNA transposons hAT are particularly frequent hAT (named from hobo (Drosophila), Ac-Ds (maize), and Tam3 (Antirrhinum) transposon are characterized by an 8 bp TSD8 bp TSD, and short TIRs of 5–27 bpshort TIRs of 5–27 bp flanking a transposase (sometimes degenerate) including a DDE site. Non-autonomous (sometimes called MITEs, miniature inverted transposable elements) derivatives of hAT elements are also found, with deletion of most of the coding sequence, and may amplify to huge copy numbers. Menzel, Schmidt, Nouroz, HH in prep 2013
  • 14. RetroelementsRetroelements Homologous BAC sequences from Calcutta 4 Homologous over the full length except for a 5kb insert a Ty1-copia retroelement
  • 15. 01/07/13 19 Sr. No. Primer Pairs Product Size (bp) Sequence 1. hAT18486 hAT19037 560 ACCCACCTGGCTCTTGTGTC AGCGAATGTGTTTTGACCAC MBP 81C12 (M. balbisiana) x MA4 82I11 (M. acuminata) BACs. Musa balbisiana (MBP 81C12) Musaacuminata(MA482I11) Transposed Element hAT 1 hAT 2 hAT 4 Microsatellite (AT) hAT 3621 bp MBT 384 bp TE + 781 MITE 1676 TE Microsatellite (AT) 4192 bp TE
  • 16. 01/07/13 20 Sr. No. Primer Pairs Product Size (bp) Sequence 1. hAT18486 hAT19037 560 ACCCACCTGGCTCTTGTGTC AGCGAATGTGTTTTGACCAC MBP 81C12 (M. balbisiana) x MA4 82I11 (M. acuminata) BACs. Musa balbisiana (MBP 81C12) Musaacuminata(MA482I11) Transposed Element hAT 1 hAT 2 hAT 4 Microsatellite (AT) hAT 3621 bp MBT 384 bp TE + 781 MITE 1676 TE Microsatellite (AT) 4192 bp TE
  • 17. A-genome specific hAT in three Musa hybrids (2n=3x=33) Musa ‘Williams Cavendish’ (AAA) Musa (ABB) Musa (ABB)
  • 18. 01/07/13 22 Dot plot showing the complete Inverted repeat.
  • 19. 01/07/13 23 HP-1 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 1KB 800 600 400 200 hAT1 insertion sites in Musa diversity collection hAT486F and hAT037R Top bands (560-bp) amplified hAT element and lower bands amplifying the flanking sequences only – Menzel, Nouroz, Schmidt, Schwarzacher, Heslop-Harrison 2013/14
  • 20. Retroelement Markers Retrotransposon LTRLTR Retrotransposon LTRLTR RetrotransposonLTR LTR Retrotransposon LTRLTR Insertion IRAP – InterRetroelement PCR Retrotransposon LTRLTR RetrotransposonLTR LTR
  • 21. IRAP diversity in MusaIRAP diversity in Musa Teo, Tan, Ho, Faridah, Othman, HH, Kalendar, Schulman 2005 J Plant Biol Nair, Teo, Schwarzacher, HH 2006 Euphytica Teo, Schwarzacher et al. in prep.
  • 22. 01/07/13 26Phylogenetic analysis of Musa genomes – separating species. Teo, Schwarzacher et al.
  • 23. Diploid 2n=2x=22 Musa / banana metaphase probed red with transposable element
  • 24. Timing of LTR Retrotransposon insertion in Musa Red 0 to 2 Mya, yellow 2 to 4 Mya, green 4 to 6 Mya and blue older D’Hont et al. 2012
  • 25. The Banana GenomeThe Banana Genome Seven countries + international organization coordinated by Angelique D’Hont - France (CIRAD, Genoscope)
  • 26. 523 Mb DH-Pahang genome size (flow cytometry) 27.5 million Roche/454 single reads 16 x coverage 2.1 million Sanger reads 4 x coverage 50.3 x of Illumina data 54 BAC sequences (1%)
  • 27. A D’Hont et al. Nature 000, 1-5 (2012) doi:10.1038/nature11241 Six-way Venn diagram showing the distribution of shared gene families (sequence clusters) among M. acuminata, P. dactylifera, Arabidopsis thaliana, Oryza sativa, Sorghum bicolor and Brachypodium distachyon genomes.
  • 28. A D’Hont et al. Nature 000, 1-5 (2012) doi:10.1038/nature11241 Whole-genome duplication events.
  • 29. A D’Hont et al. Nature 2012 doi:10.1038/nature11241
  • 30. A D’Hont et al. Nature 2012 doi:10.1038/nature11241
  • 31. 1010 µµmm DNA methylation is unevenly distributed onDNA methylation is unevenly distributed on MusaMusa chromosomeschromosomes copiacopia elementselements in methylatedin methylated regions, but alsoregions, but also in some lowin some low methylatedmethylated regions (arrows)regions (arrows) 5MeC
  • 32. 1010 µµmm C.H Teo and Schwarzacher 5MeC DNA methylation is unevenly distributed onDNA methylation is unevenly distributed on MusaMusa chromosomeschromosomes gypsygypsy elementselements in methylatedin methylated regions, but alsoregions, but also in some lowin some low methylatedmethylated regions (arrows)regions (arrows) Teo &Teo & Schwarzacher inSchwarzacher in prep 2013prep 2013
  • 33. Arachis hypogaeaArachis hypogaea - Peanut- Peanut Tetraploid of recent origin,Tetraploid of recent origin, ancestors separated only 3 My agoancestors separated only 3 My ago Ana Claudia Araujo, David Bertioli, PHH et al. Embrapa, Brasília. Annals Botany in press 2013
  • 34. A2n=4x=40probed (A.duranered)A.ipaënsis  Be
  • 35. Arachis duranensis BAC probes on A. hypogea chromosomes Right: green BAC AD52G19;red AD79O23 Below: red AD51I17 Below right: green AD179B13;red 5S rDNA
  • 36. paradox in the evolution of genome structure: the predominant repetitive DNA genome fraction is in evolutionary flux, whilst, at the same time, low copy number DNA is conserved over evolutionary time
  • 37. Size and location of chromosome regions from radish (Raphanus sativus) carrying the fertility restorer Rfk1 gene and transfer to spring turnip rape (Brassica rapa) DAPI metaphase blue Radish genomic red (labels 2 radish chromosomes and 45S rDNA) Rfk1 carrying BAC green labels sites on radish and homoeologous pair in Brassica Tarja Niemelä, Seppänen, Badakshi, Rokka HH Chromosome Research 2012
  • 38. Recent polyploidy ◦ Revealed by cytogenetics and hybridization Recent rearrangements or duplications ◦ Revealed by molecular cytogenetics Ancient, evolutionary polyploidy ◦ Revealed by sequencing Understanding polyploidy is important for speciation, evolution and breeding Different sequence classes evolve at different rates and many are saltatory rather than clocks Consequences and applications
  • 39. Anything special about cropAnything special about crop genomes?genomes? Crop Genome size 2n Ploidy Food Rice 400 Mb 24 2 3x endosperm Wheat 17,000 Mbp 42 6 3x endosperm Maize 950 Mbp 10 4 (palaeo-tetraploid) 3x endosperm Potato 900 Mbp 48 4 Modifed leaf Sugar beet 758 Mbp 18 2 Modified root Cassava 770 Mbp 36 2 Tuber Peanut 2,800 Mbp 40 4 Seed cotyledon Oil palm 3,400 Mbp 32 Fruit mesocarp Banana 523 Mbp 2x 33 3 Fruit mesocarp Heslop-Harrison 2012. www.tinyurl.com/domest
  • 40. 50 years of plant breeding50 years of plant breeding progressprogress Global production figuresGlobal production figures Agronomy& Nitrogen Genetics Transgenic Bt insect-resistant maize (& herbicide tolerant)
  • 41. CytoGenomics …CytoGenomics … The genepool has the diversity to address these challenges … New methods to exploit and characterize germplasm let use make better and sustainable use of the genepool
  • 42. www.molcyt.comwww.molcyt.com phh4@le.ac.ukphh4@le.ac.uk Recent polyploidy ◦ Revealed by cytogenetics and hybridization Recent rearrangements or duplications ◦ Revealed by molecular cytogenetics Ancient, evolutionary polyploidy ◦ Revealed by sequencing Understanding polyploidy is important for speciation, evolution and breeding Different sequence classes evolve at different rates and many are saltatory rather than clocks Consequences and applications
  • 43. geneticists Association e 2013 Dublin Polyploidy: ancient andPolyploidy: ancient and modern signatures inmodern signatures in karyotypes of crops andkaryotypes of crops and breeding materialbreeding material Pat Heslop-Harrison Phh4@le.ac.uk Website: www.molcyt.com or www.molecularcytogenetics.com UserID/PW ‘visitor’ To download full text of papers